View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_124 (Length: 237)
Name: NF1441_high_124
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 55016114 - 55016320
Alignment:
| Q |
13 |
cagagatattgagagtgttctcaaagaagtcatgctcattacgcttcctaagcttccagattttttaccggttttaacaccattattccgcggacatgtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55016114 |
cagagatattgagagtgttctcaaagaagtcatgctcattacgcttcctaagcttccagattttttaccggttttaacaccattattccgcggacatgtg |
55016213 |
T |
|
| Q |
113 |
aaggaagcgaagaagctgaggaagaaacagctggagcttatagtgccgttgataaggaaacggaaagtttacgtgaaaagtgatggaaaatgtggagatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55016214 |
aaggaagcgaagaagctgaggaagaaacagctggagcttatagcgccgttgataaggaaacggaaagtttacgtggaaagtgatggaaaatgtggagatc |
55016313 |
T |
|
| Q |
213 |
ccgaaat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
55016314 |
ccgaaat |
55016320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University