View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_132 (Length: 235)
Name: NF1441_high_132
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_132 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 21194578 - 21194797
Alignment:
| Q |
1 |
taacttccatcattggaagtaattcaaatccaaacaataatggtacgaccaatggtacaagtggagaccagaattgcaataaagcgtagtttaaagactt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
21194578 |
taacttccatcgttggaagtaattcaaatccaaataataatggtactaccaatggtacaagtggagaccagaattgcaataaatcataatttaaagactt |
21194677 |
T |
|
| Q |
101 |
cacttgcaatattaagcatggttttaaattgcagtccgcgactgcaattttggcagccgtataaagatttctgagctctctttaagggcatcgcaactaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21194678 |
cacttgcaatattaagcatggttttaaattgcagtccgcgaccgcaattttggcagccgtataaagatttctgagctctctttattggcatcgcaactaa |
21194777 |
T |
|
| Q |
201 |
aattttggccgtatgtgtcg |
220 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
21194778 |
aattttggctgtatgtgtcg |
21194797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 11283780 - 11283739
Alignment:
| Q |
113 |
taagcatggttttaaattgcagtccgcgactgcaattttggc |
154 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11283780 |
taagcatggttttaaattgcagcccgcaactgcaattttggc |
11283739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University