View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_134 (Length: 234)
Name: NF1441_high_134
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_134 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 8449437 - 8449629
Alignment:
| Q |
1 |
gttgctcaccaccaaatgaccttatgattatctctgataacacttgtcacctttttactaaaacactttttattaatannnnnnnncactcttttcacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8449437 |
gttgctcaccaccaaatgaccttatgattatctctgataacacttgtcacctttttactaaaacactttttattaatatttcttttcactcttttcacta |
8449536 |
T |
|
| Q |
101 |
gagttattatcttctctctcatatatagtatatatgtattgatattaacactcacatacatcacatcctgtttggttataattcaaacatgat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8449537 |
gagttattatcttctctctcatatatagtatatatgtattgatattaacactcacatacatcacatcctgtttggttataattcaaacatgat |
8449629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University