View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_141 (Length: 229)
Name: NF1441_high_141
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_141 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 42630160 - 42630369
Alignment:
| Q |
20 |
gacagacccattgttatctgaaggagcaacttgtttcacaggttcctccacttcctcattgttctctttcacagccaaaaccatcaaaactaacaataag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42630160 |
gacagacccattgttatctgaaggagcaacttgtttgacaggttcctccacttcctcattgctctctttcacagccaaaaccatcaaaactaacaataag |
42630259 |
T |
|
| Q |
120 |
ggatagcttaatgtagttagtacccaattcacaatcaactgtgccattggagacacgttatggttatcaatttgccatgcaactgcagcccccgcactct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42630260 |
ggatagcttaatgtagttagtacccaattgacaatcaactgtgccattggagacacgttatggttatcaatttgccatgcaactgcagcccccgcactct |
42630359 |
T |
|
| Q |
220 |
gtattccttt |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
42630360 |
gtattccttt |
42630369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 77 - 229
Target Start/End: Original strand, 42637103 - 42637255
Alignment:
| Q |
77 |
attgttctctttcacagccaaaaccatcaaaactaacaataagggatagcttaatgtagttagtacccaattcacaatcaactgtgccattggagacacg |
176 |
Q |
| |
|
||||| |||||||||| |||||| ||| ||||| |||||||| |||||||||| |||||| || |||||||||||||||||||||| ||||||||| || |
|
|
| T |
42637103 |
attgtcctctttcacaaccaaaatcattaaaaccaacaataacggatagcttagtgtagtgagcacccaattcacaatcaactgtgtcattggagataca |
42637202 |
T |
|
| Q |
177 |
ttatggttatcaatttgccatgcaactgcagcccccgcactctgtattccttt |
229 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42637203 |
ttgtggttatcaatttgccatgcaactgcagcccccgcactctgtatcccttt |
42637255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University