View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_146 (Length: 224)
Name: NF1441_high_146
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_146 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 38 - 209
Target Start/End: Complemental strand, 12675604 - 12675433
Alignment:
| Q |
38 |
ttttttgcttataatcgtgacaggatggagtaatgatttcattacttattacgttaatcgttttaattgctgcaatttgatttcaaaggaaagtaaactc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12675604 |
ttttttgcttataatcgtgacaggatggagtaatgatttcattacttattaggttaatcgttttaattgctgcaatttgatttcaaaggaaagtaaactc |
12675505 |
T |
|
| Q |
138 |
cagatagataagagtactgaaaaccaaaaagtctcaaaggctgtaatgttttcagccttctgcttaattagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12675504 |
cagatagataagagtactgaaaaccaaaaagtctcaaaggctgtaatgttttcagccttctgcttaattagt |
12675433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 12675669 - 12675638
Alignment:
| Q |
1 |
tcacatttataaaataaaatactattttgtag |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12675669 |
tcacatttataaaataaaatactattttgtag |
12675638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University