View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_148 (Length: 223)
Name: NF1441_high_148
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_148 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 43933509 - 43933317
Alignment:
| Q |
15 |
atgaacaagatgattggaatgctgatatgtctcagttattcattggtgccaaatttgattctgggagacatagcaggatctacagaggtatctataagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933509 |
atgaacaagatgattggaatgctgatatgtctcagttattcattggtgccaaatttgattctgggagacatagcaggatctacagaggtatctataagaa |
43933410 |
T |
|
| Q |
115 |
catggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgcttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43933409 |
catggatgttgctattaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgcttt |
43933317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 29 - 207
Target Start/End: Complemental strand, 35133074 - 35132896
Alignment:
| Q |
29 |
tggaatgctgatatgtctcagttattcattggtgccaaatttgattctgggagacatagcaggatctacagaggtatctataagaacatggatgttgcta |
128 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||| | ||||||| |||||| ||||| || || ||||| |||||| | || ||| | | ||||||||| | |
|
|
| T |
35133074 |
tggagtgcagatatgtctcagttgctcattggatctaaatttgcttctggtagacacagtagaatctatagaggtgtttacaagcaaaaggatgttgcaa |
35132975 |
T |
|
| Q |
129 |
ttaagcttgttagtcaaccagaagaggatgaggaattggctgctttgcttgagaaacactttacttctgaggttgcttt |
207 |
Q |
| |
|
|||||||||| ||||| || ||||| ||||| || |||||| |||| |||||||| || ||||||||||| |||||||| |
|
|
| T |
35132974 |
ttaagcttgtgagtcagcctgaagaagatgaagatttggcttcttttcttgagaagcaatttacttctgaagttgcttt |
35132896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University