View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_152 (Length: 216)
Name: NF1441_high_152
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_152 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 50407557 - 50407400
Alignment:
| Q |
18 |
tctcatgtcaataaaggttggttcaattgcgtaagtactcaattgattannnnnnnnnagatactctacaattgcacaagttatccatataaagttctcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
50407557 |
tctcatgtcaataaaggttggttcaattgcgtaagtactcaattgatt-------tatagatactctacaattgcactagttatcgatataaagttctcg |
50407465 |
T |
 |
| Q |
118 |
taattttattttttgagaatacttttaaatatatctataataagtgtttctctaaaccttagcac |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407464 |
taattttattttttgagaatacttttaaatatatctataataagtgtttctctaaaccttagcac |
50407400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University