View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_155 (Length: 210)
Name: NF1441_high_155
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_155 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 2 - 191
Target Start/End: Complemental strand, 31991038 - 31990849
Alignment:
| Q |
2 |
ttcttgattcatgcaatatgaagtggaaagaatttctcactcatgatgaatccaccacataaattaggatgttcttgattaagataaaaaatctaaaaga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31991038 |
ttcttgattcatgcaatatgaagtggaaataatttctcactcatgatgaatccaccacataaattaggatgttcttgattaagatcaaaaatccaaaaga |
31990939 |
T |
 |
| Q |
102 |
caaaattcttatttacccaacnnnnnnnnattgataatgtagttgtcacccatccaaaaattgaagagaaacaaaactaactcccaatca |
191 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31990938 |
caaaattcttatttacccaacttttttttattgataatgtagttgtcatccatccaaaaattgaagagaaacaaaactaattcccaatca |
31990849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University