View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_high_156 (Length: 203)

Name: NF1441_high_156
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_high_156
NF1441_high_156
[»] chr2 (1 HSPs)
chr2 (19-110)||(45152756-45152847)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 45152756 - 45152847
Alignment:
19 gtggcgatgatatccaccacggagatggtggaggagaaaatattaaaggcattggcggtggaattattaaaggcgggtgaaagacaacagga 110  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
45152756 gtggcgatgatatccaccatggagatggtggaggagaaaatattaaaggcattggcggtggaattattaaaggcggttgaaagacaacagga 45152847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University