View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_156 (Length: 203)
Name: NF1441_high_156
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_156 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 45152756 - 45152847
Alignment:
| Q |
19 |
gtggcgatgatatccaccacggagatggtggaggagaaaatattaaaggcattggcggtggaattattaaaggcgggtgaaagacaacagga |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45152756 |
gtggcgatgatatccaccatggagatggtggaggagaaaatattaaaggcattggcggtggaattattaaaggcggttgaaagacaacagga |
45152847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University