View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_35 (Length: 364)
Name: NF1441_high_35
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 42 - 266
Target Start/End: Original strand, 8849226 - 8849453
Alignment:
| Q |
42 |
tcttgacgagatctctttggagaccgaacagatctagaagatgaaggtggtaagattgtcgttgatgctgtgaaacaattttgacacatgttgtttgttg |
141 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8849226 |
tcttgacgagatctcttcggagaccgaacagatctagaagatgaaggtggtaagattgtcgttgatgctgtgaaacaattttgacacatgttgtttgttg |
8849325 |
T |
|
| Q |
142 |
aagggtttccgacaacaccacagtttttgatacaaagatttatta---ttggtgtttgttgaagggtttctgaaactaccttaaattcggtttcttcatt |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8849326 |
aagggtttccgacaacaccgcagtttttgatacaaagatttattattgttgttgtttgttgaagggtttctgaaaccaccttaaattcggtttcttcatt |
8849425 |
T |
|
| Q |
239 |
ttctgttctttgagccataaaaatttat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8849426 |
ttctgttctttgagccataaaaatttat |
8849453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University