View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_54 (Length: 312)
Name: NF1441_high_54
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 298
Target Start/End: Original strand, 41116445 - 41116733
Alignment:
| Q |
10 |
catcatcagtgagatcagattcaagatgaataggagcattgtatcccctcaacaaagatggaacgggcctctcaaagatatcaattaataatttaataca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
41116445 |
catcatcagtgagatcagattcaagatgaataggagcattgtatcccctcaacaaagatggaacgagcctatcaaagatatcaattaataatttaataca |
41116544 |
T |
|
| Q |
110 |
aactctccttctttctgcagtgaatacaaataaatttgtcattcaaattaatgatgaaaaaccatgatcgacaataacatttcaacaaaaatagtaagat |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41116545 |
aactccccttctttctgcagtgaatacaaataaatttgtcattcaaattaatgatgaaaaaccatgatcgacaataacatttcaacaaaaatagtaagat |
41116644 |
T |
|
| Q |
210 |
atttctttcagcaactttgacgagtgaagggacatgtgacatggtaatataattaactgatatgtagtaaaataatttttccaaatttg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41116645 |
atttctttcagcaactttgacgagtgaagggaaatgtgacatggtaatataattaactgatatgtagcaaaataatttttccaaatttg |
41116733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 41102913 - 41102995
Alignment:
| Q |
10 |
catcatcagtgagatcagattcaagatgaataggagcattgtatcccctcaacaaagatggaacgggcctctcaaagatatca |
92 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
41102913 |
catcatcagtgagatcggattcaagacgaataggagcactgtatccccttaacaaagatggaacaggcctctcaaagatatca |
41102995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University