View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_high_58 (Length: 301)

Name: NF1441_high_58
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_high_58
NF1441_high_58
[»] chr4 (1 HSPs)
chr4 (19-280)||(30412502-30412763)


Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 30412763 - 30412502
Alignment:
19 aaagcagcaccgttgaatcatctgtccctgctcctgagcgtgaggtcacgcgccgagaagttcccaccggcggtagcgtcatggatcggttcccttttct 118  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30412763 aaagcagcaccgttgaatcatctgtccctgctcctgaccgtgaggtcacgcgccgagaagttcccaccggcggtagcgtcatggatcggttcccttttct 30412664  T
119 ctcgattcagcaacagatcatgccgtttgctggtgctggtgccggtgctgttgatggaatggtgccagttttcttttacgatccagcgggtcgagctgag 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30412663 ctcgattcagcaacagatcatgccgtttgctggtgctggtgccggtgctgttgatggaatggtgccagttttcttttacgatccagcgggtcgagctgag 30412564  T
219 tttttgaaccagcggtttactaacaggtttgaaccggaaccggttcagtttaacatcgggtt 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30412563 tttttgaaccagcggtttactaacaggtttgaaccggaaccggttcagtttaacatcgggtt 30412502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University