View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_65 (Length: 289)
Name: NF1441_high_65
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 274
Target Start/End: Original strand, 41775526 - 41775791
Alignment:
| Q |
10 |
attattctcttcataggtttgttactttttcttgctttcatttcaatcacttctcattagttcaaaattgaattattgaccgaatatatgtcttttcttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41775526 |
attattctcttcataggtttgttactttttcttgctttcatttcaatcacttcttattagttcaaaattgaattattgaccgaatatatgtcttttcttt |
41775625 |
T |
 |
| Q |
110 |
ttggataggaacttcttcaaggtctttctttaagggaactgagatgtggaaagaagagactcttctaaaggtaaaactttcacaactttaagactatgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41775626 |
ttggataggaacttcttcaaggtctttctttaagggaactgagatgtggaaagaagagactcttctaaaggtaaaactttcacaactttaagactatgaa |
41775725 |
T |
 |
| Q |
210 |
tattctataactcatttgaatatactcaacagctttttctctgt-tttttgttaaattgcagaaag |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41775726 |
tattctataactcatttgaatatactcaacagctttttctctgtgtttttgttaaattgcagaaag |
41775791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University