View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_67 (Length: 287)
Name: NF1441_high_67
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_67 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 115 - 187
Target Start/End: Original strand, 103863 - 103935
Alignment:
| Q |
115 |
aacatatgattattttaatttgattaagtaaccatatataaacaatgaaataatctcaactaatttaagttag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
103863 |
aacatatgattattttaatttgattaagtaaccatatataaacaatgaaataatcacaactaatttaagttag |
103935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 115 - 187
Target Start/End: Complemental strand, 41087248 - 41087176
Alignment:
| Q |
115 |
aacatatgattattttaatttgattaagtaaccatatataaacaatgaaataatctcaactaatttaagttag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41087248 |
aacatatgattattttaatttgattaagtaaccatatataaacaatgaaataatcacaactaatttaagttag |
41087176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University