View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_85 (Length: 261)
Name: NF1441_high_85
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 36810166 - 36809915
Alignment:
| Q |
1 |
tcaatagtatgtgattctatgcaaagtttttaccacttgtttcttaagatcagcacataaaaaccacttgtgtgtttttataaacttggttgnnnnnnnc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||||||||||||||||| | |
|
|
| T |
36810166 |
tcaatagtatgtgattctatgcaaagtttttaccacttgtttctcaagaccagcacatcaaaaccactt--gtgtttttataaacttggttgtttttttc |
36810069 |
T |
 |
| Q |
101 |
tctttcaatatacaacttgttaaagcgtttagg-nnnnnnnnataccacttgtttttacgtccaaaacaacacaaccacttgtgnnnnnnngtatatctc |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36810068 |
tctttcaatataccacttgttaaagcgtttaggtttttttttataccacttgtttttacgcccaaaacaacacaaccacttgtg-ttttttgtatatctc |
36809970 |
T |
 |
| Q |
200 |
gtgatagccattggttggtacttggtattccaatgtgctaagatccagaataatct |
255 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
36809969 |
gtgatagcctttggttggtacttggta-tccaatgtgctaagatccaaaataatct |
36809915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University