View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_94 (Length: 250)
Name: NF1441_high_94
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_94 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 40639646 - 40639889
Alignment:
| Q |
8 |
tgaaatgaatttgccaccattgatgagctatcatgactaatacagatggataaaacgcttattatttattttgttaataatataaagtacttannnnnnn |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639646 |
tgaaatgaatttgccacaattgatgagctatcatgactaatgcagatggataaaacgcttattatttattttgttaataatataaagtacttattttttt |
40639745 |
T |
 |
| Q |
108 |
-gctaataatataaaacacttctattatgaataggttttcccttttattatcatgtatagttggtttaaagatgaaaaccgtaaagaaggtgaatctact |
206 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639746 |
tgctaatgatataaaacacttctattatgaataggttttcccttttattatcatgtatagttggtttaaagatgaaaaccgtaaagaaggtgaatctact |
40639845 |
T |
 |
| Q |
207 |
ctagcgttgatttgagcggtgtttcccattgtaatggcatcatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639846 |
ctagcgttgatttgagcggtgtttcccattgtaatggcatcatt |
40639889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 40643685 - 40643736
Alignment:
| Q |
11 |
aatgaatttgccaccattgatgagctatcatgactaatacagatggataaaa |
62 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
40643685 |
aatgaattggccacaattgatgagatatcatgactaatgtagatggataaaa |
40643736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University