View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_103 (Length: 249)
Name: NF1441_low_103
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 19524616 - 19524861
Alignment:
| Q |
1 |
attggtttaatacaggttttattccatgtttttggccattttcaactggactaaggaaggctcattctatgtttatttaagattatctcatataatgaat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19524616 |
attggtttaatacatgttttattccatgtttttggccattttcaactggactaaggaaggctcattctatgtttatttaagattatctcatccaatgaat |
19524715 |
T |
 |
| Q |
101 |
atggcac----ttgcgtcaattctatcatattatgatggtgatataagatgtatttaatcctacttttagtttcat---ttgtgggttagctttgatcat |
193 |
Q |
| |
|
||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19524716 |
atggcacgagctcgcatcaattctatcatattatgatggtgatataagatgtatttaatcctacttttagtttcattaattgggggttagctttgatcat |
19524815 |
T |
 |
| Q |
194 |
attaggtcatgtcatattttcatcctttctacactgctatcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19524816 |
attaggtcatgtcatattttcatcctttctacactgctatcttttg |
19524861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University