View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_107 (Length: 247)
Name: NF1441_low_107
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_107 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 6043328 - 6043274
Alignment:
| Q |
175 |
ctccttcaaaatatcgtgctttattttatttggggtcctttcctatgtacttcat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6043328 |
ctccttcaaaatatcgtgctttattttatttggggtcctttcctatgtacttcat |
6043274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 6043486 - 6043436
Alignment:
| Q |
16 |
atgaagaaaataagagagaaatataatttaatgtcttcttgctacatggag |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6043486 |
atgaagaaaataagagagaaatataattgaatgtcttcttgctacatggag |
6043436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University