View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_11 (Length: 479)
Name: NF1441_low_11
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 73 - 301
Target Start/End: Complemental strand, 40353076 - 40352849
Alignment:
| Q |
73 |
aactaatttattcagatttatattattgtttcttttgtaagggtgatcaatgatcattgttacttctacagaaaatagatctgcctataagtacaatatt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
40353076 |
aactaatttattcagatttatattattgtttcttttgtaagggtgatcaatgatcgttgttacttctacaggaaacagatctgtctataagtacaatatt |
40352977 |
T |
|
| Q |
173 |
cactcaagtttcagaaccttctattaaaagatgattttgttatactaattgacaaagacacctcgttaaattatggaatttatcaggtatgttaatgtga |
272 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
40352976 |
cactca-gtttcagaaccttttattaaaagatgattttgttatactaattgacaaagacgcctcgctaaattatggaatttatcaggtatgttaatgcga |
40352878 |
T |
|
| Q |
273 |
cagtgactgtgcttcatagaacactaaca |
301 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
40352877 |
caatgactgtgcttcatagaacactaaca |
40352849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 371 - 471
Target Start/End: Complemental strand, 40352779 - 40352679
Alignment:
| Q |
371 |
tattgactcttagaacactaatacataaaacataaaaggaggttagaagacaacattgacgtatttcttactacaatctccattttgcacatgttcatct |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40352779 |
tattgactcttagaacactaatacataaaacatgaaaggaggttagaagataacattgacgtatttcttactacaatctccattttgcacatgttaatct |
40352680 |
T |
|
| Q |
471 |
c |
471 |
Q |
| |
|
| |
|
|
| T |
40352679 |
c |
40352679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 40353122 - 40353087
Alignment:
| Q |
1 |
cagtgaaatacgtaatgtctttaacaatatctatat |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40353122 |
cagtgaaatacgtaatgtctttaacaatatctatat |
40353087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University