View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_115 (Length: 240)
Name: NF1441_low_115
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_115 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 36810259 - 36810484
Alignment:
| Q |
1 |
tatgcatattcctattctaggatgcttggctcatggtccacaatgcctgtaatgtgagactctagcacatgaccatgctaaaattttgtgtttttatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810259 |
tatgcatattcctattctaggatgcttggctcatggtccacaatgcctgtaatgtgagactctagcacatgaccatgctaaaattttgtgtttttatgga |
36810358 |
T |
 |
| Q |
101 |
actgtctattgctggaaaccgttttttgcagtgagaaactgttaggaaagtggccaataggattgaacctaagtttgctgctgaaaagacaatgcaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36810359 |
actgtctattgctggaaaccgttttttgcagtgagaaactgttaggaaagtggccaataggattgaacctaagtttgctgctgaaaagacaatgcaacca |
36810458 |
T |
 |
| Q |
201 |
ttgttaatatgaatgtggtttttatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36810459 |
ttgttaatatgaatgtggtttttatt |
36810484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University