View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_119 (Length: 239)
Name: NF1441_low_119
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_119 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 49291456 - 49291680
Alignment:
| Q |
1 |
ttagtcaatccaacctattgagatgatgtttgttaattgttgtagtatctccttttcacagtttagttatgcgagtaagtttgatatacnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
49291456 |
ttagtcaatccaacctattgagaagatgtttgttaattgttgtagtatctccttttcacagttcagttatgcgagtaattttgatatacttttttttttt |
49291555 |
T |
 |
| Q |
101 |
nn-gagagaagtaattttgatatactattgtggtcttatctgaaaatatttttattttaaaacttaagcatggctctatggcttaggcatcattttgcag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49291556 |
tttgagagaagtaattttgatatactattgtggtcttatctgaaaatatttttattttaaaacttaagcatggctctatggcttaggcatcattttgcag |
49291655 |
T |
 |
| Q |
200 |
tgccattatttcaagtatagctctg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49291656 |
tgccattatttcaagtatagctctg |
49291680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University