View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_123 (Length: 238)
Name: NF1441_low_123
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_123 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 140263 - 140044
Alignment:
| Q |
1 |
tctgataacggtaaggagctagcattggcagcaatatatgcatcaacttgttacttgaagagaaggaaattgtggaatactcttggtaatttgttaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
140263 |
tctgataacggtaaggagctagcattggcagcaatatatgcatcaacttgttacttgaagagaaggaaattgtggaatactcttggtaatttgttaagtc |
140164 |
T |
 |
| Q |
101 |
agttcagcctcccttggaactttattggtgattttaacacaatattgggagcttatgaacatcagggcaactgctctccttctagaactcccatgcaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
140163 |
agttcagcctcccttggaactttattggtgattttaacacaatattgggagcttatgaacatcagggaaactgctctccttctagaactcccatgcaaga |
140064 |
T |
 |
| Q |
201 |
ttttcaagcatggacagata |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
140063 |
ttttcaagcatggacagata |
140044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 32 - 220
Target Start/End: Complemental strand, 3566154 - 3565966
Alignment:
| Q |
32 |
caatatatgcatcaacttgttacttgaagagaaggaaattgtggaatactcttggtaatttgttaagtcagttcagcctcccttggaactttattggtga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3566154 |
caatatatgcatcaacttgttacttgaagagaaggaaattgtggaatactcttggtgatttgttaagtcagttcagcctcccttggaactttactggtga |
3566055 |
T |
 |
| Q |
132 |
ttttaacacaatattgggagcttatgaacatcagggcaactgctctccttctagaactcccatgcaagattttcaagcatggacagata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3566054 |
ttttaacacaatattgggagcttatgaacatcagggaaactgctctccttctagaactcccatgcaagattttcaagcatggacagata |
3565966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 66
Target Start/End: Complemental strand, 9751832 - 9751769
Alignment:
| Q |
3 |
tgataacggtaaggagctagcattggcagcaatatatgcatcaacttgttacttgaagagaagg |
66 |
Q |
| |
|
|||||| ||||||||| | ||| ||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9751832 |
tgataatggtaaggagtttgcaatggttgcagtctatgcatcaacttgttacttgaagagaagg |
9751769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University