View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_low_136 (Length: 234)

Name: NF1441_low_136
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_low_136
NF1441_low_136
[»] chr5 (1 HSPs)
chr5 (1-193)||(8449437-8449629)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 8449437 - 8449629
Alignment:
1 gttgctcaccaccaaatgaccttatgattatctctgataacacttgtcacctttttactaaaacactttttattaatannnnnnnncactcttttcacta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||    
8449437 gttgctcaccaccaaatgaccttatgattatctctgataacacttgtcacctttttactaaaacactttttattaatatttcttttcactcttttcacta 8449536  T
101 gagttattatcttctctctcatatatagtatatatgtattgatattaacactcacatacatcacatcctgtttggttataattcaaacatgat 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8449537 gagttattatcttctctctcatatatagtatatatgtattgatattaacactcacatacatcacatcctgtttggttataattcaaacatgat 8449629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University