View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441_low_159 (Length: 207)

Name: NF1441_low_159
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441_low_159
NF1441_low_159
[»] chr1 (1 HSPs)
chr1 (11-194)||(8413692-8413875)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 8413875 - 8413692
Alignment:
11 cagagagtaaaaataaagagnnnnnnntgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt 110  Q
    ||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8413875 cagagagtaaaaataaagagaaaaaaatgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt 8413776  T
111 gttacacgacggtccggacaccatcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaaga 194  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8413775 gttacacgacggtccggacaccgtcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaaga 8413692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University