View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_159 (Length: 207)
Name: NF1441_low_159
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_159 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 8413875 - 8413692
Alignment:
| Q |
11 |
cagagagtaaaaataaagagnnnnnnntgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413875 |
cagagagtaaaaataaagagaaaaaaatgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt |
8413776 |
T |
 |
| Q |
111 |
gttacacgacggtccggacaccatcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaaga |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413775 |
gttacacgacggtccggacaccgtcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaaga |
8413692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University