View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_42 (Length: 349)
Name: NF1441_low_42
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 194 - 343
Target Start/End: Complemental strand, 45153015 - 45152866
Alignment:
| Q |
194 |
cttaaggtgtgacccattttacctatatctatatggatattgtggacagtggccttttcctacttaccgttcaccaaacaatccatttgatcaaacacca |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153015 |
cttaaggtgtgacccattttacctatatctatatggatattgtggacagtggccttttcctacttaccgttcaccaaacaatccatttgatcaaacacca |
45152916 |
T |
 |
| Q |
294 |
cccccctttcgttcctttccacgccccccacgacttatccctccaccttt |
343 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45152915 |
cccccctttcgttactttccacgccccccacgacttatccctccaccttt |
45152866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 3 - 121
Target Start/End: Complemental strand, 45153206 - 45153088
Alignment:
| Q |
3 |
gagtgagatgaagaaatggattcaaacaaagtactaatagctctactaacccttgttttgctctttcattactctcttactgaaagtacaacactttctc |
102 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153206 |
gagtgaaacgaagaaatggattcaaacaaagtactaatagctctactaacccttgttttgctctttcattactctcttactgaaagtacaacactttctc |
45153107 |
T |
 |
| Q |
103 |
ataaccatcatagacacct |
121 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45153106 |
ataaccatcatagacacct |
45153088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University