View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_53 (Length: 314)
Name: NF1441_low_53
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 305
Target Start/End: Complemental strand, 31784369 - 31784074
Alignment:
| Q |
13 |
gagacgaggtggcggaggaccgattcgaatggcttcatcggaagatgcgacgtggagggagtttctatcggcgtcgctgtaaacagcgacggtgcgaatt |
112 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784369 |
gagacgagcaggtggaggaccgattcgaatggcttcatcggaagatgcgacgtggagggagtttctatcggcgtcgctgtaaacagcgacggtgcgaatt |
31784270 |
T |
 |
| Q |
113 |
ccgagtcgttttgcggttcttgtgattctgcatgctatttcgcctctgtttgctattagaattttttctattcgttcttttttctttggttccgatgatg |
212 |
Q |
| |
|
||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784269 |
ccgagtctcttagcggttctggtgattctgcatgctatttcgcctctgtttgctattagaattttttctattcgttcttttttctttggttccgatgatg |
31784170 |
T |
 |
| Q |
213 |
agaactcacgtgcgcgcacgtgacggtttgagtgtgtgaagttggttttgattttggtagtagcatttcgacgg---agtaagaagaataaggaag |
305 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |||||||||||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31784169 |
agaactcacgtgcgcgcacgtgacagtttgagtgcgtgaggttggttttgatcttggtattagcatttcgacggaatagtaagaagaataaggaag |
31784074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University