View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_63 (Length: 292)
Name: NF1441_low_63
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 116243 - 116520
Alignment:
| Q |
1 |
acctcttcatgaacatatttatcatata--tatttaagtcagcataaatattaaactatgcgtgtgttgtgggccacatttaggtgatacacattggtct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
116243 |
acctcttcatgaacatatttatcatatacatatttaagtcaacataaatattaaactatgcgtgtgttgtggcccacatttaggtgatacacattggtct |
116342 |
T |
 |
| Q |
99 |
atgtttttagactattaataataattgattagttaaactaacaagctcgtgggtaggtaggtgtgtttcatgattgaattaggttagtttattccnnnnn |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
116343 |
atgtttttagactattaataataattgattagttaaactaacaagctcgtgggtaggtaggtgtctttcatgattgaattaggttagtttattccaaaaa |
116442 |
T |
 |
| Q |
199 |
nnggaaaacatcctatccaatttcttttagttttgttgttcggctattgcattgccattggtttgattgaaaataaac |
276 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116443 |
aagaaaaacatcctatccaatttcttttagttttgttgttcggctattgcattgccattggtttgattgaaaataaac |
116520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University