View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_70 (Length: 283)
Name: NF1441_low_70
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 39365572 - 39365300
Alignment:
| Q |
1 |
gtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtacctt---------attttgtacattttcatcttcct |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39365572 |
gtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtaccttcgtttgcttattttgtacattttcatcttcct |
39365473 |
T |
 |
| Q |
92 |
tccaagcataaggtaatagtgatcatatgattttttgtatgtatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaaggtgacggtgaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365472 |
tccaagcataaggtaatagtgatcatatgattttttgtatttatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaaggtgacggtgaat |
39365373 |
T |
 |
| Q |
192 |
ggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365372 |
ggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttc |
39365300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University