View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_71 (Length: 281)
Name: NF1441_low_71
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 4 - 248
Target Start/End: Original strand, 24940263 - 24940507
Alignment:
| Q |
4 |
atagcgaacgtaatgcaattagaaatcaagaattgcgacgttttaagtcacgttacttaagaatgaaatttagaatagcgcatagatgcaggaacgattg |
103 |
Q |
| |
|
|||||||| | ||| |||||| |||||||||||| ||||||| |||||| |||||||||||| ||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
24940263 |
atagcgaatgcaatacaattaaaaatcaagaattatgacgtttcaagtcatgttacttaagaacgaagtttagaatagcgcgtagttgcaggaacgattg |
24940362 |
T |
 |
| Q |
104 |
cggttgtactgcaattttttaatattacgaagaatcacagtcaaatgtgaatatgatcgatttggtcaagcataaattgctcttgtgttgtgattcaact |
203 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
24940363 |
cggttgtactgcaatttttgaatattatgaagaatcacagtcaaatatgaatatgatcgatttggccaagcataaattgctcttttgttgtgattcaact |
24940462 |
T |
 |
| Q |
204 |
aatttctcagtattgcattttgttcaatgtacatattatatactt |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24940463 |
aatttctgagtattgcattttgttcaatgtacatattatatactt |
24940507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University