View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_82 (Length: 265)
Name: NF1441_low_82
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 35524019 - 35524269
Alignment:
| Q |
1 |
gatgatggtgatgttgaagagtgtggaggaccatataaggagcatccaaagaaagagcacgtatgtgggcgcccgcttgggctgtgctttaatgtagcat |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524019 |
gatgatgatgatgttgaagagtgtggaggaccatataaggagcatccaaagaaagagcacatatgtgggcgcccgcttgggctgtgctttaatgtagcat |
35524118 |
T |
 |
| Q |
101 |
ctggtcaactttatgttgctgatgcatacatgggactagttgttattgaatccaccggcggcattgctagaaaagtcatatcacatgcagtagaaggtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524119 |
ctggtcaactttatgttgctgatgcatacatgggactagttgttattgaacccaccggcggcattgctagaaaagtcatatcacatgcagtagaaggtca |
35524218 |
T |
 |
| Q |
201 |
acctttggctttcacaaacagtttggatattgatcaacgaactggagcagt |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524219 |
accgttggctttcacaaacagtttggatattgatcaacgaactggagcagt |
35524269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 251
Target Start/End: Original strand, 35520432 - 35520680
Alignment:
| Q |
3 |
tgatggtgatgttgaagagtgtggaggaccatataaggagcatccaaagaaagagcacgtatgtgggcgcccgcttgggctgtgctttaatgtagcatct |
102 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||| ||||||||||| |||||||| ||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35520432 |
tgatgatgatgttgatgagtgtcgaggaccatacaaggagcatcctaagaaagaacacatatgtgggcgtccgcttgggctgtgctttaatgtagcatct |
35520531 |
T |
 |
| Q |
103 |
ggtcaactttatgttgctgatgcatacatgggactagttgttattgaatccaccggcggcattgctagaaaagtcatatcacatgcagtagaaggtcaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520532 |
ggtcaactttatgttgctgatgcatacatgggactagttgttattgaatccaccggcggcattgctagaaaagtcatatcacatgcagtagaaggtcaac |
35520631 |
T |
 |
| Q |
203 |
ctttggctttcacaaacagtttggatattgatcaacgaactggagcagt |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520632 |
ctttagctttcacaaacagtttggatattgatcaacgaactggagcagt |
35520680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 35527011 - 35527072
Alignment:
| Q |
141 |
tgttattgaatccaccggcggcattgctagaaaagtcatatcacatgcagtagaaggtcaac |
202 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35527011 |
tgttattgaacccactggtagcattgctagaaaagtcatatcacatgcagtagaaggtcaac |
35527072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University