View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_85 (Length: 263)
Name: NF1441_low_85
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 105 - 257
Target Start/End: Complemental strand, 53033947 - 53033795
Alignment:
| Q |
105 |
tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagctttgtccatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033947 |
tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagctttgtccatg |
53033848 |
T |
 |
| Q |
205 |
aatgccagtagtgaattgtagtaaccatccacgttcaacagccccacctatgc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53033847 |
aatgccagtagtgaattgtagtaaccatccacgttcaacagccccacctatgc |
53033795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 105 - 194
Target Start/End: Complemental strand, 7885514 - 7885425
Alignment:
| Q |
105 |
tacctcaagtttgcacatgaggtcttgggcagtgtgggcagatacaataatgtgacgggcagctggtgttacaaaaccttcatccacagc |
194 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || ||||| |||||||| ||||| ||||| |||||| ||||||||||| ||||| |
|
|
| T |
7885514 |
tacctcaagcttgcacatgaggtcctgagcagtatgtgcagacacaataatatgacgagcagcctgtgttatgaaaccttcatctacagc |
7885425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University