View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_86 (Length: 261)
Name: NF1441_low_86
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 43412837 - 43413055
Alignment:
| Q |
17 |
atgaactgaaagtgaaagtgatggttttgtttggttgaggcttgtggcagtgaatgaatgaatggtaatgaatgagaaaaggtttatgagtctgaatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43412837 |
atgaactgaaagtgaaagtgatggttttgtttggttgaggcttgtggcagtgaatgaatg----------aatgagaaaaggtttatgagtctgaatgaa |
43412926 |
T |
 |
| Q |
117 |
ctcaacaactccaaaaaagacgactttgcttgtccatcattagtcaagtcatcaccattcaccaatggctttgtggcaatgtgatgttttgctgagtcat |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43412927 |
ctcaacaactccaaaagagacgactttgcttgtccatcattagtcaagtcatcaccattcaccaatggctttgtggcaatgtgatgttttgctgagtcat |
43413026 |
T |
 |
| Q |
217 |
gtttggtttctgacactggatgcttttcc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43413027 |
gtttggtttctgacactggatgcttttcc |
43413055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University