View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_89 (Length: 257)
Name: NF1441_low_89
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_89 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 38626052 - 38625820
Alignment:
| Q |
20 |
ctgctacaggagaaaacataaaattggtatgaagtaagttatgcatgatgtttataacttctattgtttttactttgattcaaatactgggattctattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626052 |
ctgctacaggagaaaacataaaattggtatgaagtaagttatgcatgatgtttataacttctattgtttttactttgattcaaatactgggattctattt |
38625953 |
T |
|
| Q |
120 |
gttttcaatgatcaaaatgaaatgtttttgaatcgtaagaacatgcttcattatattttcagctaatactaccacttctgtaaagaaaatttcttacttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38625952 |
gttttcaatgatcaaaatgaaatgtttttgaatcgtaagaacatgcttcattatattttcagctaatactgccacttctgtaaagaaaatttcttacttg |
38625853 |
T |
|
| Q |
220 |
tatgtcctagcattagacggttcctttgctact |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38625852 |
tatgtcctagcattagacggttcctttgctact |
38625820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University