View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_low_99 (Length: 250)
Name: NF1441_low_99
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_low_99 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 44955315 - 44955078
Alignment:
| Q |
1 |
cacttgtctcttaagttatatacacttaaaaaataaatataaatgtagtagagtatatagctatattttaatacaattaaacttttagtgcannnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44955315 |
cacttgtctcttaagttatatacgcttaaaaaataaatataaatgtagtagagtatatagctatagtttaatacaattaaacttttagtgcatttttttt |
44955216 |
T |
|
| Q |
101 |
nnnctatttttgaaaataagcgtccttaattaacgtacggttggttcatcagcttcttttaccaaaccaaccaactatgattaactagcttttctaacca |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44955215 |
t--ctatttttgaaaataagtgtccttaattaacgtacggtcggttcatcagcttcttttaccaaaccaaccaactatgattaactagcttttctaacca |
44955118 |
T |
|
| Q |
201 |
tagatgtttacctatccaactacataacaataaagtataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44955117 |
tagatgtttacctatccaactacataacaataaagtataa |
44955078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University