View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1442-Insertion-11 (Length: 217)
Name: NF1442-Insertion-11
Description: NF1442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1442-Insertion-11 |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold1694 (1 HSPs) |
 |  |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold1120 (1 HSPs) |
 |  |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |
|
| [»] scaffold0549 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 31)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 148
Target Start/End: Original strand, 40295292 - 40295430
Alignment:
| Q |
7 |
attttctccatcaaagataaagaagcagcttgtgaattattattgttgatgcttgaattttgacatcattctatcatcatgatgtatattaacaatattc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40295292 |
attttctccatcaaagataaagaagcagcttgtgaattattattgttgatgcttgaattttgacatcattctatcatcatgatgtatattaacaa---tc |
40295388 |
T |
 |
| Q |
107 |
acttcgtaactttcctattgaaatttcacttctcacggataa |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40295389 |
acttcctaactttcctattgaaatttcacttctcacggataa |
40295430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 40295450 - 40295498
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
40295450 |
ggtagccggggtttgaacctcgaatcttgcatacattatgcattgttca |
40295498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 7206190 - 7206149
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
7206190 |
gccggggtttaaacctcggaccttgcatatattatgcattgt |
7206149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 29544692 - 29544651
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29544692 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 42791360 - 42791319
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
42791360 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
42791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 20200770 - 20200726
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
20200770 |
gccggggtttgaaccctggaccttgcatatattatgcattgttca |
20200726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 24581015 - 24581055
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
24581015 |
cggggtttgaacctcgaaccttgcatatattatgcattgtt |
24581055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 28771646 - 28771606
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
28771646 |
ccggggttcgaaccgcggatcttgcatatattatgcattgt |
28771606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Complemental strand, 10724004 - 10723965
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
10724004 |
gccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 12413556 - 12413517
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
12413517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 12425616 - 12425577
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
12425577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 18693660 - 18693699
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18693660 |
cggggtttgaaccctggatcttgcatatattatgcattgt |
18693699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Complemental strand, 27848223 - 27848184
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
27848223 |
gccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 29734754 - 29734715
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29734754 |
cggggtttgaaccacggaccttgcatatattatgcattgt |
29734715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 31815885 - 31815924
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31815885 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
31815924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 216
Target Start/End: Original strand, 43356542 - 43356581
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43356542 |
gggttcgaacctcggaccttgcatatattatgcattgttc |
43356581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 211
Target Start/End: Original strand, 10735827 - 10735865
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcat |
211 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
10735827 |
gccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 20565074 - 20565112
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20565074 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
20565112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 25186241 - 25186279
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
25186279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 43117189 - 43117227
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgt |
43117227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 11175850 - 11175809
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
11175850 |
gccggagtttgaaccccagatcttgcatatattatgcattgt |
11175809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 22359066 - 22359029
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22359066 |
gggtttgaactgcggatcttgcatatattatgcattgt |
22359029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 22709150 - 22709109
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
22709150 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
22709109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 23250318 - 23250359
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
23250318 |
cggggtttgaaccctggaccttgcatatattatgcattgttc |
23250359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 24592842 - 24592883
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
24592842 |
gccggggtttgaaccccagaccttgcatatattatgcattgt |
24592883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 41778940 - 41778981
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
41778940 |
gccgggattcgaacctcggaccttgcatatattatgcattgt |
41778981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 24393309 - 24393269
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
24393309 |
ccggggttcgaacctcagaccttgcatatattatgcattgt |
24393269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 31543074 - 31543038
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
31543074 |
ggggtttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 32204609 - 32204565
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||| |||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
32204609 |
gccgaggttcgaatcttggatcttgcatatattatgcattgttca |
32204565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 36359374 - 36359338
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgt |
36359338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 45032753 - 45032717
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45032753 |
ggtttgagcctcagatcttgcatatattatgcattgt |
45032717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 30)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 8809369 - 8809329
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8809369 |
cggggtttgaacctcggatcttgcatatattatgcattgtt |
8809329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 15187126 - 15187087
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15187126 |
cggggtttgaacctcggaccttgcatatattatgcattgt |
15187087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 15473480 - 15473519
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15473480 |
cggggtttgaacctcggaccttgcatatattatgcattgt |
15473519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 2692276 - 2692239
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2692276 |
gggtttgaatctcggatcttgcatatattatgcattgt |
2692239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 8569774 - 8569733
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8569774 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
8569733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 8637437 - 8637474
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgt |
8637474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 28758288 - 28758329
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28758288 |
cggggtttgaacctcggactttgcatatattatgcattgttc |
28758329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 31971590 - 31971553
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatgcattgt |
31971553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 9392660 - 9392708
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
9392660 |
ggtagtcggggtttaaacctcggaccttgcatatattatgcatttttca |
9392708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 34701212 - 34701169
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
34701212 |
gccggagtttgaacctcagaccttgcatatattatgcattgttc |
34701169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 3808117 - 3808155
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3808117 |
ggggtttgaatctcggaccttgcatatattatgcattgt |
3808155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 9111110 - 9111068
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcattgttca |
9111068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 13496179 - 13496137
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
13496179 |
cggggtttgaactccggaccttgcatatattatgcattgttca |
13496137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 34481412 - 34481454
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
34481412 |
cggggtttgaaccccggaccttgcatatataatgcattgttca |
34481454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 655745 - 655786
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
655745 |
gccggggttcgaaccccggaccttgcatatattatgcattgt |
655786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 2655023 - 2655064
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
2655023 |
gccggggtttgaaccccggatcttacatattttatgcattgt |
2655064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 217
Target Start/End: Complemental strand, 12215811 - 12215774
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcattgttca |
12215774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 16125029 - 16125066
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16125029 |
tttgaacctcggactttgcatatattatgcattgttca |
16125066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 18253338 - 18253379
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18253338 |
ggggtttgaaccctggaccttgcatatattatgcattgttca |
18253379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 29740547 - 29740506
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
29740547 |
gccggggtttgaaccccggaccttgcgtatattatgcattgt |
29740506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 33824946 - 33824905
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
33824946 |
gccgaggtttgaaccccggaccttgcatatattatgcattgt |
33824905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 33976309 - 33976268
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
33976309 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
33976268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 1606700 - 1606656
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||| ||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
1606700 |
gccggagtttgaatctcggatcttgcatattttatacattgttca |
1606656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 2726414 - 2726454
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
2726414 |
ccggggttcgaaccccggaccttgcatatattatgcattgt |
2726454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 3358451 - 3358415
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3358451 |
ggtttgaacctcggactttgcatatattatgcattgt |
3358415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 6864134 - 6864170
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6864134 |
ggtttgaatatcggatcttgcatatattatgcattgt |
6864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 12184573 - 12184529
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
12184573 |
gccgggatttgaaccacggaccttgcatatattatgcattattca |
12184529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 17113462 - 17113498
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |
|
|
| T |
17113462 |
gtttgaacctcagaccttgcatatattatgcattgtt |
17113498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 216
Target Start/End: Original strand, 32193862 - 32193898
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
32193862 |
tttgaacctcgtaccttgcatatattatgcattgttc |
32193898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 34474292 - 34474248
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34474292 |
gccggggttcgaaccatggaccttgcatatattatgcattgttca |
34474248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 36)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 56551588 - 56551629
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56551588 |
gccggggtttgaacctcggaccttgcatatattatgcattgt |
56551629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 19479475 - 19479517
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19479475 |
cggggtttgaaccccggaccttgcatatattatgcattgttca |
19479517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 40070966 - 40071008
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
40070966 |
cggggtttgaacttcggaccttgcatatattatgcattgttca |
40071008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 13121613 - 13121568
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
13121613 |
ggtagccggggtttgaacttcagaccttgcatatattatgcattgt |
13121568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 31138989 - 31139030
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
31138989 |
gccggggtttgaacctcggaccttgcatattttatgcattgt |
31139030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 37921815 - 37921770
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
37921815 |
ggtagccggggtttgaatcccggaccttgcatatattatgcattgt |
37921770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 43034338 - 43034379
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43034338 |
gccggggtttgaacctcagaccttgcatatattatgcattgt |
43034379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 43155142 - 43155105
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43155142 |
cggggtttgaacctcagatcttgcatatattatgcatt |
43155105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 49041977 - 49042018
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
49041977 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
49042018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 3936692 - 3936648
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3936692 |
gccggggttcgaaccccggaccttgcatatattatgcattgttca |
3936648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 217
Target Start/End: Original strand, 24675061 - 24675109
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24675061 |
ggtagccgggatttgaaccccaaatcttgcatatattatgcattgttca |
24675109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 11949761 - 11949800
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
11949761 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
11949800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 19908755 - 19908716
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19908755 |
cggggttcgaacctcggaccttgcatatattatgcattgt |
19908716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 22630358 - 22630397
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
22630358 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
22630397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 217
Target Start/End: Complemental strand, 28568269 - 28568226
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
28568269 |
ccggggtttgaaccccgaatcttgtatatattatgcattgttca |
28568226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 37930845 - 37930884
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
37930845 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 675980 - 675942
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
675942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 217
Target Start/End: Complemental strand, 12917694 - 12917656
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12917694 |
gtttgaacctcggattttgcatacattatgcattgttca |
12917656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 20383550 - 20383512
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
20383512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 54294419 - 54294457
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
54294419 |
ccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 54857611 - 54857653
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
54857611 |
gccggggtttgaaccccggaccttgcatattttatgcattgtt |
54857653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 7230345 - 7230304
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
7230345 |
gccgaggtttgaaccccggaccttgcatatattatgcattgt |
7230304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 8027395 - 8027432
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
8027395 |
cggggtttgaacccccgatcttgcatatattatgcatt |
8027432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 8415495 - 8415532
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
8415495 |
gggtttgaaccttggatcttacatatattatgcattgt |
8415532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 10564457 - 10564502
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||| ||||| |
|
|
| T |
10564457 |
ggtagccggggtttgaacctcagaccttacatatattatgtattgt |
10564502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 11198393 - 11198352
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
11198393 |
gccggggtttgaaccccggaccttgcatatattatgccttgt |
11198352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 20799394 - 20799431
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcattgt |
20799431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 30135203 - 30135166
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30135203 |
cggggtttgaacctcggatctgacatatattatgcatt |
30135166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 42344620 - 42344657
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
42344620 |
gtttgaacctcggaccttgcatatattatacattgttc |
42344657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 12322733 - 12322697
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgt |
12322697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 14197432 - 14197468
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
14197432 |
ggtttgaaccccggatcttacatatattatgcattgt |
14197468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 19854625 - 19854589
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
19854625 |
ggttcgaaccccggatcttgcatatattatgcattgt |
19854589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 25783446 - 25783486
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
25783446 |
ccggagtttgaaccccggaccttgcatatattatgcattgt |
25783486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 35287503 - 35287547
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||| ||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
35287503 |
gccggggttggaaccccggaccttgcatattttatgcattgttca |
35287547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 52132295 - 52132339
Alignment:
| Q |
170 |
gtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| ||||| | || ||||||||||||||||||||| |
|
|
| T |
52132295 |
gtagccggggttcgaaccacagaccttgcatatattatgcattgt |
52132339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 10922300 - 10922345
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10922300 |
ggtagtcggggtttgaaccccggatcttgcatatattatgcattgt |
10922345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 22722465 - 22722423
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22722465 |
cggggtttgaacctcggaccttgcatattttatgcattgttca |
22722423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 8075850 - 8075809
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8075850 |
gccggggtttgaacctcagaccttgcatatattatgcattgt |
8075809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 11358299 - 11358258
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11358299 |
gccggggtttgaaccccggatcttgcatatattatgaattgt |
11358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 38130955 - 38130996
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
38130955 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 48849759 - 48849800
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
48849759 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 51882196 - 51882237
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51882196 |
gccggggtttgaaccctggatcttgcatatattatgcattgt |
51882237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 34899160 - 34899121
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34899160 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
34899121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 214
Target Start/End: Original strand, 2584011 - 2584045
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2584011 |
tttgaacctcggatcttgcatatataatgcattgt |
2584045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 4601909 - 4601868
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
4601909 |
gccggggtttgaaccccggaccttgcatttattatgcattgt |
4601868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 5349589 - 5349552
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5349589 |
gggtttgaacctcggaccttgcatatataatgcattgt |
5349552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 8113558 - 8113599
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
8113558 |
gccgggattcgaaccgcggatcttgcatatattatgcattgt |
8113599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 14827590 - 14827549
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
14827590 |
gccggggtttaaaccccggatcttgcatattttatgcattgt |
14827549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Original strand, 24120422 - 24120455
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
24120422 |
gtttgaaccgcggatcttgcatatattatgcatt |
24120455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 24348446 - 24348409
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24348446 |
gtttgaacctctgaccttgcatatattatgcattgttc |
24348409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 24428473 - 24428510
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24428473 |
gggtttgaacctcggactttgcatatattatgcattgt |
24428510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 25340920 - 25340961
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
25340920 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
25340961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 25441496 - 25441537
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
25441496 |
gccggggtttgaaccccagaccttgcatatattatgcattgt |
25441537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 28430567 - 28430604
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
28430567 |
gtttgaacctcagaccttgcatatattatgcattgttc |
28430604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 30050424 - 30050465
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
30050424 |
gccggagtttgaaccgcgaatcttgcatatattatgcattgt |
30050465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 216
Target Start/End: Original strand, 38869524 - 38869557
Alignment:
| Q |
183 |
gaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
38869524 |
gaacctcggatcttgtatatattatgcattgttc |
38869557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 41817560 - 41817523
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
41817560 |
gggtttgaaccccggaccttgcatatattatgcattgt |
41817523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 45432009 - 45431972
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
45432009 |
gggtttgaaccccggaccttgcatatattatgcattgt |
45431972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 210
Target Start/End: Original strand, 45885473 - 45885510
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgca |
210 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
45885473 |
gccggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 47536476 - 47536517
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
47536476 |
gccggagtttgaacctcggaccttgcatattttatgcattgt |
47536517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 8136630 - 8136666
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcat |
211 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8136630 |
cggggtttgaaccttggaccttgcatatattatgcat |
8136666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 12746354 - 12746394
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
12746354 |
ccggggattgaatctcggaccttgcatatattatgcattgt |
12746394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 16792971 - 16793011
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16792971 |
ccggggtttgaaccctggaccttgcatatattatgcattgt |
16793011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 20612273 - 20612317
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
20612273 |
gccggggtttgaaccccaaaccttgcatatattatgcattgttca |
20612317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 41990583 - 41990623
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
41990583 |
ggggttcgaacctcggaccttgcatatattatgtattgttc |
41990623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 42074168 - 42074124
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||| ||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
42074168 |
gccggagttcgaacctcagaccttgcatatattatgcattgttca |
42074124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 48656900 - 48656936
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgt |
48656936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 30)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 18533731 - 18533691
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18533731 |
ggggtttgaaccccggatcttgcatatattatgcattgttc |
18533691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 12748966 - 12748925
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
12748966 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 13286195 - 13286155
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13286195 |
gccggggtttgaacc-cggatcttgcatatattatgcattgt |
13286155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 24696006 - 24696043
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24696006 |
gggtttgaatctcggatcttgcatatattatgcattgt |
24696043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 32051528 - 32051569
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32051528 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 33105453 - 33105412
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33105453 |
ggggtttgaaccccggaccttgcatatattatgcattgttca |
33105412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 13124359 - 13124403
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
13124359 |
gccggggtttgaaccccggaccttgcatattttatgcattgttca |
13124403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 42208470 - 42208506
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcattgt |
42208506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 11709049 - 11709010
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
11709049 |
cggggtttgaacttcggaccttgcatatattatgcattgt |
11709010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 23159504 - 23159465
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23159504 |
cggggtttgaaccccgaatcttgcatatattatgcattgt |
23159465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 35102668 - 35102703
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattg |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35102668 |
ggttcgaacctcggatcttgcatatattatgcattg |
35102703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 42172242 - 42172280
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42172242 |
ggggtttgaactccggatcttgcatatattatgcattgt |
42172280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 444478 - 444437
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
444478 |
gccggggtttaaaccccggaccttgcatatattatgcattgt |
444437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 5728601 - 5728560
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
5728601 |
cggggtttaaacttcggagcttgcatatattatgcattgttc |
5728560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 8881340 - 8881299
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8881340 |
gccggggtttgaaccctggaccttgcatatattatgcattgt |
8881299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 9241080 - 9241039
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
9241080 |
gccggggtttgaacatcggaccttacatatattatgcattgt |
9241039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 10601828 - 10601787
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
10601828 |
gccggggtttgaatcccgaatcttgcatatattatgcattgt |
10601787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 13357437 - 13357478
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
13357437 |
gccgaggtttgaacctcgtaccttgcatatattatgcattgt |
13357478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 15001271 - 15001312
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
15001271 |
gccggggtttgaaccttggaccttgcatattttatgcattgt |
15001312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 15020822 - 15020785
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
15020822 |
gggtttgaaccccggatcttgcatatattatacattgt |
15020785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 19260575 - 19260616
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
19260575 |
gccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 24023413 - 24023454
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
24023413 |
cggggtttgaaccccggaccttgcatattttatgcattgttc |
24023454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 24838166 - 24838207
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
24838166 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
24838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 27587286 - 27587245
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
27587286 |
gccggggtttgaaccccggaccttgcatatatcatgcattgt |
27587245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 30176416 - 30176453
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcat |
211 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
30176416 |
ccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 210
Target Start/End: Original strand, 32286360 - 32286397
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgca |
210 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32286360 |
gccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 37117527 - 37117564
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
37117527 |
tttgaacctcagatcttgaatatattatgcattgttca |
37117564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 4263873 - 4263837
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4263873 |
tttgaacctcggaccttgcatacattatgcattgttc |
4263837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 7553743 - 7553703
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7553743 |
ccggagtttgaaccttggaccttgcatatattatgcattgt |
7553703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 26196600 - 26196644
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||| ||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
26196600 |
gccggagtttgaaccacgaaccttgcatatattatgcattgttca |
26196644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 29)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 6000140 - 6000180
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6000140 |
ccggggtttgaacctcggaccttgcatatattatgcattgt |
6000180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 25533040 - 25532997
Alignment:
| Q |
171 |
tagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
25533040 |
tagccggggtttgaaccccggaccttgcatatattatgcattgt |
25532997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 174 - 216
Target Start/End: Original strand, 28798746 - 28798788
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
28798746 |
ccggggtttgaacctcggatcttacatatattatacattgttc |
28798788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 12268982 - 12269023
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12268982 |
cggggtttgaaccccggaccttgcatatattatgcattgttc |
12269023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 34632234 - 34632193
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
34632234 |
gccgggatttgaacctcggatcttgcatatattatacattgt |
34632193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 1794656 - 1794620
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1794656 |
ggtttgaaccccggatcttgcatatattatgcattgt |
1794620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 17221519 - 17221559
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
17221519 |
ggggttcgaacctcggaccttgcatatattatgcattgttc |
17221559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 22335421 - 22335382
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
22335421 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
22335382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 33153878 - 33153917
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
33153878 |
cggggtttgaacctcggaccttacatatattatgcattgt |
33153917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 17537752 - 17537710
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
17537752 |
gccggggtttgaacaccggatcttgtatatattatgcattgtt |
17537710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 28832169 - 28832211
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
28832169 |
cgggatttgaacctcagaccttgcatatattatgcattgttca |
28832211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 33020042 - 33020080
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33020042 |
ggggtttgaacctcagaccttgcatatattatgcattgt |
33020080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 8736500 - 8736459
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
8736500 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
8736459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 10654447 - 10654484
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
10654447 |
gggtttgaaccacggaccttgcatatattatgcattgt |
10654484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 14880893 - 14880852
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
14880893 |
gccgggatttgaacctcagaccttgcatatattatgcattgt |
14880852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 16967190 - 16967231
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
16967190 |
gccggagtttgaacctcgaaccttgcatatattatgcattgt |
16967231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 29739406 - 29739361
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| |||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
29739406 |
ggtagccgaggtttgaaccccggaccttgcatattttatgcattgt |
29739361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 34521186 - 34521227
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34521186 |
gccgaggtttgaaccccggaccttgcatatattatgcattgt |
34521227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 41973320 - 41973279
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
41973320 |
gccggggttcgaaccccggaccttgcatatattatgcattgt |
41973279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 45773534 - 45773579
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||| ||||||||||| |
|
|
| T |
45773534 |
ggtagccggggtttgaaccacagatcttgtatattttatgcattgt |
45773579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 5907863 - 5907823
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5907863 |
ccggggtttgaaccctggaccttgcatatattatgcattgt |
5907823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 11681287 - 11681247
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
11681287 |
ccggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 215
Target Start/End: Original strand, 14343909 - 14343949
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
14343909 |
cggggttcgaacctcgaatcttgcatatattatgcactgtt |
14343949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 15382815 - 15382859
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
15382815 |
gccgggtttcgaacctcggaccttgcatatattatacattgttca |
15382859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 15668560 - 15668520
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
15668560 |
ggggtttgaaccccggaccttgcatattttatgcattgttc |
15668520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 217
Target Start/End: Complemental strand, 24695620 - 24695580
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
24695620 |
gggtttgaacctcgaattttgcatatattatgtattgttca |
24695580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 28979279 - 28979311
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
28979279 |
tttgaacctcgaatcttgcatatattatgcatt |
28979311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Original strand, 46579649 - 46579684
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46579649 |
ggggtttgaac-tcggatcttgcatatattatgcatt |
46579684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Original strand, 47528444 - 47528484
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
47528444 |
ccggggttcgaacctcggaccttgcgtatattatgcattgt |
47528484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 217
Target Start/End: Complemental strand, 22975 - 22932
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22975 |
ccggggtttgaacctcggaccttgcatattttatgcattgttca |
22932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 27462432 - 27462473
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
27462432 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
27462473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 37307872 - 37307913
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37307872 |
cgggatttgaacatcggatcttgcatatattatgcattgttc |
37307913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 217
Target Start/End: Complemental strand, 7670494 - 7670455
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7670494 |
ggtttgaaccccggaccttgcatatattatgcattgttca |
7670455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Original strand, 14046607 - 14046646
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
14046607 |
gccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 212
Target Start/End: Original strand, 14356637 - 14356676
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
14356637 |
gccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 18714511 - 18714472
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
18714511 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
18714472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 19599208 - 19599169
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19599208 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
19599169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 20085758 - 20085796
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
20085796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Original strand, 28736632 - 28736670
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
28736632 |
ggggtttgaacctcggaccttgcatatatcatgcattgt |
28736670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 216
Target Start/End: Original strand, 1285075 - 1285108
Alignment:
| Q |
183 |
gaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
1285075 |
gaaccccggatcttgcatatattatgcattgttc |
1285108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 8237628 - 8237669
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
8237628 |
gccggggtttgaacctcggactttgtatatattatgcattgt |
8237669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Complemental strand, 10244788 - 10244751
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgt |
10244751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 18505650 - 18505694
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
18505650 |
ggtagtcggggtttgaacc-cggatcttgcatattttatgcattgt |
18505694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 19416579 - 19416538
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
19416579 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
19416538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 19626521 - 19626562
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19626521 |
gccggtgtttgaaccccggaccttgcatatattatgcattgt |
19626562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 39280820 - 39280857
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgttc |
39280857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 41250045 - 41250086
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
41250045 |
cggggcttgaacctcggaccttgcatatattatacattgttc |
41250086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 42829230 - 42829271
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
42829230 |
gccggagtttgaaccccggagcttgcatatattatgcattgt |
42829271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 46737850 - 46737809
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
46737850 |
gccggtgtttgaaccccggaccttgcatatattatgcattgt |
46737809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 2512374 - 2512338
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgc |
209 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
2512374 |
gccggggtttgaacctcgtaccttgcatatattatgc |
2512338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 10327018 - 10326975
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
10327018 |
gccgaggtttgaacct-ggaccttgcatatattatgcattgttca |
10326975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 46987150 - 46987110
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
46987150 |
ccggggttcgaaccccggaccttgcatatattatgcattgt |
46987110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 22)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 22522797 - 22522838
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
22522797 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 40715945 - 40715986
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40715945 |
gccggggtttgaaccccggaccttgcatatattatgcattgt |
40715986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 16579374 - 16579414
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16579374 |
gggtttgaaccacggaccttgcatatattatgcattgttca |
16579414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 22394094 - 22394059
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22394094 |
gtttgaacctcggatcttacatatattatgcattgt |
22394059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 173 - 216
Target Start/End: Complemental strand, 42473959 - 42473916
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42473959 |
gccgtggtttgaaccccggaccttgcatatattatgcattgttc |
42473916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 5107243 - 5107285
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
5107243 |
cggggttcgaacctcggaccttgcatatattatgcattattca |
5107285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 13864407 - 13864365
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
13864407 |
cggggtttgaaccccggaccttgcatatattatgtattgttca |
13864365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 214
Target Start/End: Complemental strand, 20927697 - 20927663
Alignment:
| Q |
180 |
tttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20927697 |
tttgaacctcggatcttgcatatattatgtattgt |
20927663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 31602823 - 31602865
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
31602823 |
cggggtttgaatctcgaaccttgcatatattatgcattgttca |
31602865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 31877990 - 31877952
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcattgt |
31877952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 6489072 - 6489031
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
6489072 |
gccggggtttgaaccccagaccttgcatatattatgcattgt |
6489031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 6624841 - 6624800
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
6624841 |
gccggggttcgaaccccggaccttgcatatattatgcattgt |
6624800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 10531609 - 10531564
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
10531609 |
ggtagtcggggtttgaaccacggaccgtgcatatattatgcattgt |
10531564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 16133061 - 16133102
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
16133061 |
gccggggtttaaacctctgaccttgcatatattatgcattgt |
16133102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 20721119 - 20721074
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||| ||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
20721119 |
ggtagtcggggtttgaaccccggaccttgcatatattatgtattgt |
20721074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 34191498 - 34191457
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
34191498 |
gccggggtttgaaccccggaccttgcatattttatgcattgt |
34191457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 40459243 - 40459280
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
40459243 |
ggggtttgaacctcggatattgcatatattatgtattg |
40459280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 1538810 - 1538846
Alignment:
| Q |
179 |
gtttgaacctcggatcttgcatatattatgcattgtt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1538810 |
gtttgaacctcggaccttgcatatattatgcgttgtt |
1538846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 14474899 - 14474855
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
14474899 |
gccggggtttgaaccctggaccttgcatatattatgcgttgttca |
14474855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 18147782 - 18147742
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
18147782 |
ccgggggttgaaccccggatcctgcatatattatgcattgt |
18147742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 217
Target Start/End: Original strand, 18589867 - 18589907
Alignment:
| Q |
177 |
gggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
|||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
18589867 |
gggtttaaaccccggaccttgcatatattatgcattgttca |
18589907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Complemental strand, 31280079 - 31280043
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31280079 |
ggtttgaaccccggatattgcatatattatgcattgt |
31280043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 1164 - 1204
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgttc |
1204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 185327 - 185287
Alignment:
| Q |
174 |
ccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
185327 |
ccggggtttgaaccccggatcttgcatattttatgcattgt |
185287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 5244 - 5206
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5244 |
ggggtttgaacctcagaccttgcatatattatgcattgt |
5206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1694 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold1694
Description:
Target: scaffold1694; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 224 - 179
Alignment:
| Q |
169 |
ggtagccggggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||| |||||||||||| || |||||||| |||||||||||| |
|
|
| T |
224 |
ggtagccgaggtttgaacctcagaccttgcatacattatgcattgt |
179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 46006 - 45969
Alignment:
| Q |
175 |
cggggtttgaacctcggatcttgcatatattatgcatt |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
46006 |
cggggttcgaacctcggatcttgcatatattatacatt |
45969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1120 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1120
Description:
Target: scaffold1120; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Complemental strand, 1975 - 1935
Alignment:
| Q |
176 |
ggggtttgaacctcggatcttgcatatattatgcattgttc |
216 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
1975 |
ggggtttgaaccacgaaccttgcatatattatgcattgttc |
1935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 6779 - 6735
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6779 |
gccggggttcgaaccatggaacttgcatatattatgcattgttca |
6735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0549 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0549
Description:
Target: scaffold0549; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Original strand, 8592 - 8636
Alignment:
| Q |
173 |
gccggggtttgaacctcggatcttgcatatattatgcattgttca |
217 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8592 |
gccggggttcgaaccatggaacttgcatatattatgcattgttca |
8636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 214
Target Start/End: Original strand, 31156 - 31192
Alignment:
| Q |
178 |
ggtttgaacctcggatcttgcatatattatgcattgt |
214 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
31156 |
ggtttgaaccgcagatcttgcatatattatgcattgt |
31192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University