View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14420_low_9 (Length: 245)
Name: NF14420_low_9
Description: NF14420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14420_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 54202984 - 54202752
Alignment:
| Q |
13 |
aacaaaggataatccgctggggagaggtgtcattggtcaagggttgtccttgtgtgcaggtggttgttgactcattttcttttttagtgtctcaattttg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54202984 |
aacaaaagataatccgctggggagaggtgtcattggtcaagggttgtccttgtgtgcaggtggttgttgactcattttcttttttagtgtctcaattttg |
54202885 |
T |
|
| Q |
113 |
cagatttatggtttatgatttatggtatcatgtgtttaatcggctagggactgttacaacactgcggaatgaagcgatggctcatctagaacaatttgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54202884 |
cagatttatggtttatgatttatggtatcatgtgtttaatcggctagggactgttacaacactgcggaatgaagcgatggctcatctataacaatttgaa |
54202785 |
T |
|
| Q |
213 |
ggcttcattagtagcggaagtgctctttatttg |
245 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
54202784 |
ggcttcattagtagcggaagtgcgctttatttg |
54202752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 161 - 245
Target Start/End: Original strand, 16718816 - 16718900
Alignment:
| Q |
161 |
gactgttacaacactgcggaatgaagcgatggctcatctagaacaatttgaaggcttcattagtagcggaagtgctctttatttg |
245 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| |||||||||||||||||||||||| ||| |||| | ||| ||||| |||||| |
|
|
| T |
16718816 |
gactgttacaacactgtgaaatgcagcgatgggtcatctagaacaatttgaaggcttgattggtagtgaaagagctctctatttg |
16718900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University