View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_24 (Length: 276)
Name: NF14421_low_24
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 47306792 - 47307037
Alignment:
| Q |
18 |
ataactttcaaacatgtcacaatcaattttacgtcttcaagatcaattttaacaatgatcgcatgagtagagtggaatctcatgaaatgtaaagcagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47306792 |
ataactttcaaacatgtcacaatcaattttacgtcttcaagatcaattttaacaatgatcgcgtgagtagagtggaatctcatgaaatgtaaagcagact |
47306891 |
T |
 |
| Q |
118 |
attattctatggcaattttggatcagaaatttattgattgtgtctgaaatggtgtaatcatgtaatatgaagttaaatttttgttctgcacgctgcttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47306892 |
attattctatggcaattttggatcagaaatttattgattgtgtctgaaatggtgtaatcatgtaatgtgaagttaaatttttgttctgcacgctgcttgt |
47306991 |
T |
 |
| Q |
218 |
tgattaattttttaatgcagccagcacctgctacctatgatgatgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47306992 |
tgattaattttttaatgcagccagcacctgctacctatgatgatgt |
47307037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University