View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_25 (Length: 275)
Name: NF14421_low_25
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 263
Target Start/End: Original strand, 13976245 - 13976490
Alignment:
| Q |
17 |
cctatcatattggttcttgaagcgataaggtgacacataacataatgactatattcgaggatataggaatgaaattcttacataatatgaaaagnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13976245 |
cctatcatattggttcttgaagggatgaagtgacacataacataatgactatattcgaggatataggaatgaaattcttacataatatgaaaag-ctttt |
13976343 |
T |
 |
| Q |
117 |
nnnnngtttgtctttttctcttcaattggattaggtttatgtctcctcaatttatttttcataaatgaatttctatcagat-nnnnnnnnnttacttata |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13976344 |
tttttgtttgtctttttc-cttcaattggattaggtttatgtctcctcaatttatttttcataaatgaatttctatcagataaaaaaaatattacttata |
13976442 |
T |
 |
| Q |
216 |
tcgttttgtgctatcataacaaatatatatctcagatgcatttgccta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13976443 |
tcgttttgtgctatcataacaaatatatatctcagatgcatttgccta |
13976490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 63 - 96
Target Start/End: Original strand, 250316 - 250349
Alignment:
| Q |
63 |
gactatattcgaggatataggaatgaaattctta |
96 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
250316 |
gactatattcgagcatataggaatgaaattctta |
250349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University