View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_26 (Length: 265)
Name: NF14421_low_26
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 23599319 - 23599576
Alignment:
| Q |
1 |
agctcgttctgtgagtatattgtactttcttcgagttata--catcagcttaatcatgtgtataatgcattattgtttttgtttgtttaccggtgtttaa |
98 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23599319 |
agctcgttctctgagtatattgtactttcttcgagttatatacatcagcttaatcatgtgtataatgcattattgtttttgtttgtttaccggtgtttaa |
23599418 |
T |
 |
| Q |
99 |
ttttgccgtgtggaattatagattggtgccttgtttggcacgtatttatagtagagttaatatctcaaataacctctctttataatgtgtgcgaagttga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23599419 |
ttttgccgtgtggaattatagattggtgccttgcttggcacgtatttattgtagagttaatatctcaaataacctctctttataatgtgtgcgaagttga |
23599518 |
T |
 |
| Q |
199 |
aaaatagtctatgtaaaactaaaaacacatattttccttgtgtgattttatattcttc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23599519 |
aaaatagtctatgtaaaactaaaaacacagattttccttgtgtgattttatattcttc |
23599576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University