View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_29 (Length: 236)
Name: NF14421_low_29
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 66 - 157
Target Start/End: Original strand, 29821990 - 29822081
Alignment:
| Q |
66 |
aattagatgttaggataattatcaatatagttaaatttctgaaaattacttttaaagttataggtttatgatggaacttttgttagtattag |
157 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
29821990 |
aattatatgttaggaaaattatcaatatggttaaatttctgaaaattacttttaaagttatatgtttatgattaaacttttgttagtattag |
29822081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University