View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_31 (Length: 206)
Name: NF14421_low_31
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 16955280 - 16955446
Alignment:
| Q |
20 |
atataaataaaaggaaaaattgatgaacaagtatttagtgaattctggtaacaaagataattttaaaactgtgataattaatcatgctcatacaa---ta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16955280 |
atataaataaaaggaaaaattgatgaacaagtatttagtgaattctggtaacaaagataattttaaaactgtgataattaatcatgctcatacaatatta |
16955379 |
T |
 |
| Q |
117 |
tgtataatataaaatgaaacattttgtacaaagtagcatacaccctataaatttcatagtaaccttat |
184 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16955380 |
tgtat-atataaaatgaaacattttgtacaaagtagcatacaccctataaatttcatagtaaccttat |
16955446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University