View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14421_low_32 (Length: 202)
Name: NF14421_low_32
Description: NF14421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14421_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 11 - 181
Target Start/End: Complemental strand, 23599352 - 23599182
Alignment:
| Q |
11 |
tcgaagaatatacaatatactcacagaacgagctaatatataactcaaacaaagtacaagaaacaaacacacgcacaatgccgaactggcagtgtataac |
110 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23599352 |
tcgaagaaagtacaatatactcagagaacgagctaatatataactcaaacaaagtacaagaaacaaacacacgcacaatgccgaactggcagtgtataac |
23599253 |
T |
|
| Q |
111 |
attggtaactttgctgatagaactaaacaaagtgcaaaagtgatgctgatgaacaaagtgtacgtgatgct |
181 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23599252 |
atttgtaactttgctgataaaactaaacaaagtgcgaaagtgatgctgatgaacaaagtgtacgtgatgct |
23599182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University