View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14422_high_5 (Length: 228)
Name: NF14422_high_5
Description: NF14422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14422_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 35046657 - 35046460
Alignment:
| Q |
18 |
atttatattgttctgttgtatggagtggagttctaagattatggagggactaaatatctatcagaaattagttgcatctttgtttcaagttacaaatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046657 |
atttatattgttctgttgtatggagtggagttctaagattatggagggactaaatatctatcagaaattagttgcatctttgtttcaagttacaaatgtt |
35046558 |
T |
|
| Q |
118 |
agacattctggtgaatctgtttttgatacatactccatctcttcagccatattggtgctcttcattgtcatgatgtaagttactatctttcttcccta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35046557 |
agacattctggtgaatctgtttttgatacatactccatctcttctgccatattggtgctcttcattgtcatgatgtaagttactatctttcttcccta |
35046460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 174
Target Start/End: Complemental strand, 35000296 - 35000140
Alignment:
| Q |
18 |
atttatattgttctgttgtatggagtggagttctaagattatggagggactaaatatctatcagaaattagttgcatctttgtttcaagttacaaatgtt |
117 |
Q |
| |
|
|||| ||||||| |||| ||||| |||||||| || |||||||||| || ||| | ||| ||||| | |||||| |||||||||||||| |||||| | |
|
|
| T |
35000296 |
atttgtattgttttgttccatggaatggagttccaatattatggaggatcttaatctatatgagaaagtggttgcaactttgtttcaagtttcaaatgct |
35000197 |
T |
|
| Q |
118 |
agacattctggtgaatctgtttttgatacatactccatctcttcagccatattggtg |
174 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
35000196 |
agacattctggtgaatctgtttttgatctctctaccatctcctcagccatattggtg |
35000140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University