View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14422_low_5 (Length: 359)
Name: NF14422_low_5
Description: NF14422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14422_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 42455321 - 42455497
Alignment:
| Q |
20 |
agtcgggcagtatgcatgagattatgacgggtctatggagcacttataaaaatcatataagtctaaatgtgcaacaatgcgataacacgataatcgtgag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455321 |
agtcgggcagtatgcatgagattatgaccggtctatggagcacttataaaaatcatataagtctaaatgtgcaacaatgcgataacacgataatcgtgag |
42455420 |
T |
|
| Q |
120 |
gttgtgatgtgaatggtagacctcttatctatacgtgtctttggttcatttaacttgctacactaatttcaatgtat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455421 |
gttgtgatgtgaatggtagacctcttatctatacgtgtctttggttcatttaacttgctacactaatttcaatgtat |
42455497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 195 - 349
Target Start/End: Original strand, 42455537 - 42455691
Alignment:
| Q |
195 |
atcactttgatgatgtttaaccaaaaaatttattttgannnnnnnnnnnnaaacttttgaatgtttgttagatattttgaatatttcaaaagtaaattaa |
294 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455537 |
atcactttgatgatgtttaaccaaaaaaattattttgattttttttttttaaacttttgaatgtttgttagatattttgaatatttcaaaagtaaattaa |
42455636 |
T |
|
| Q |
295 |
ttcacattttattttgatccaattgattaaactttgttttcataaattacctttg |
349 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455637 |
ttcacattttattttgatctaattgattaaactttgttttcataaattacctttg |
42455691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University