View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14423_high_7 (Length: 222)
Name: NF14423_high_7
Description: NF14423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14423_high_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 24779456 - 24779235
Alignment:
| Q |
1 |
gatgttgaagtgtgctggtaatgatgatatcattaccattaaggctgatgatgggagtgatactgttaccttcatgtttgaaagccctagtaagtttcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24779456 |
gatgttgaagtgtgctggtaatgatgatatcattactattaaggctgatgatgggagtgatactgttaccttcatgtttgaaagccctagtaagtttcgt |
24779357 |
T |
 |
| Q |
101 |
tttctttaccaattctgtagttttagtgttaattagggttttaattgggttaattagggttttgggttcattgttgtatgattatttcgtgctacttggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24779356 |
tttctttaccaattctgtagttttagtgttaattagggttttaattgggttaattagggttttgggttcattgttgtatgattatttcgtgctaattggg |
24779257 |
T |
 |
| Q |
201 |
ttttgggttttaattgggttaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24779256 |
ttttgggttttaattgggttaa |
24779235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University