View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14424_low_15 (Length: 393)
Name: NF14424_low_15
Description: NF14424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14424_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 4e-88; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 7173061 - 7173225
Alignment:
| Q |
1 |
gtggagaagtttcgtaagaagttcggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattccttctagacgtaaagggatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173061 |
gtggagaagtttcgtaagaagttcggtgaattgtcacagattatggagattcctgtgcttaaaggtgagattgttattccttctagacgtaaagggatta |
7173160 |
T |
|
| Q |
101 |
aaagtggtggagggaagaagaagtgagttatttgtgttggaattgtaatttgattgtatggtgtt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173161 |
aaagtggtggagggaagaagaagtgagttatttgtgttggaattgtaatttgattgtatggtgtt |
7173225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 249 - 323
Target Start/End: Original strand, 7173309 - 7173383
Alignment:
| Q |
249 |
gattgttgcgagattggcataatcactgtgagccaatgtgattttggataaccaaaactacattttggagcttcg |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173309 |
gattgttgcgagattggtataatcactgtgagccaatgtgattttggataaccaaaactacattttggagcttcg |
7173383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 337 - 377
Target Start/End: Original strand, 7173384 - 7173424
Alignment:
| Q |
337 |
gaactcatcgtgaatccaaacatacacttagatgagaaaca |
377 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||||| |
|
|
| T |
7173384 |
gaactcgttgtgaatccaaacatacacttatatgagaaaca |
7173424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University