View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14425_high_10 (Length: 220)
Name: NF14425_high_10
Description: NF14425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14425_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 12 - 209
Target Start/End: Original strand, 45053510 - 45053707
Alignment:
| Q |
12 |
gaggagaaacacactccaatgtcctacaccaacaccatcaagttatattacaacacatatacaacactactgggaataggatatatggaccatgccaaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
45053510 |
gaggagaaacacactccaatgtcctacaccaacaccatcaggttatattacgacacatatacaacactattgggaatagtatatatggaccctgccaaac |
45053609 |
T |
|
| Q |
112 |
tagggcattacacacttcggtagataataggccatgagaggtacgtatatgagctatccataataggtgttgatccgcttaaataggcatgtctgatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45053610 |
tagggcattacacacttcggtagataataggccatgagaggtacgtatatgagctatccataataggtgttgatccgctgaaataggcatgtctgatg |
45053707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University