View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14425_low_12 (Length: 238)
Name: NF14425_low_12
Description: NF14425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14425_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 39563475 - 39563332
Alignment:
| Q |
77 |
cccattaaagaaatattctaacagagttcattctagtgaaattgaatagatgggacataaaatttctccaatagatcaaataagacaacataacgcttct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39563475 |
cccattaaagaaatattctaacagagttcattctagtgaaactgaatagatgggacataaaatttctccaatagatcaaataagacaacataacgcttct |
39563376 |
T |
 |
| Q |
177 |
tttggctttgattgaatagacctgtcactgcttgtgtccccctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39563375 |
tttggctttgattgaatagacctgtcactgcttgtgtccccctt |
39563332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University