View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14425_low_13 (Length: 226)
Name: NF14425_low_13
Description: NF14425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14425_low_13 |
 |  |
|
| [»] scaffold0088 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 48929 - 49037
Alignment:
| Q |
1 |
ttttgaaaaagaacgcgatgatttagagaaactggtatatttctttatcttttctctctcgctctctccacgcaacactaattaattgtgaaagcttgca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48929 |
ttttgaaaaagaacgccatgatttagagaaactggtatatttctttatcttttctc--tcgctctctccacgcaacactaattaattgtgaaagcttgca |
49026 |
T |
 |
| Q |
101 |
taccaattgaa |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
49027 |
taccaattgaa |
49037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 108 - 179
Target Start/End: Original strand, 49080 - 49151
Alignment:
| Q |
108 |
tgaatgaaagtgtgctacaccgatccgagtaaatccctagccgcacagtgcatctcgcaagtaaaccctagc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49080 |
tgaatgaaagtgtgctacaccgatccgagtgaatccctagccgcacagtgcatctcacaagtaaaccctagc |
49151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University