View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14426_high_4 (Length: 248)
Name: NF14426_high_4
Description: NF14426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14426_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 46129677 - 46129900
Alignment:
| Q |
15 |
actgctttcacttgcaggccgtgaggtacaatatggctctttgatactttctacaagaacaattaaatcatttttgtcgtttacttttttatgaatattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46129677 |
actgctttcacttgcaggccgtgaggtacaatatggctctttgatactttctacaagaacaattaaatcatttttgtcatttacttttttatgaatattg |
46129776 |
T |
|
| Q |
115 |
gtttgtattcggtttcattaaattccttaagagcaactcttcatggcatagtctttgcattctcactttatttttctgatgcatgcagatattcacgaac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46129777 |
gtttgtattcggtttcattaaattccttaagagcaactcttcacggcatagtccttgcattctcactttatttttctgatgcatgcagatattcacgaac |
46129876 |
T |
|
| Q |
215 |
ttcctttcaagtgtgatgattcat |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46129877 |
ttcctttcaagtgtgatgattcat |
46129900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University